pSLQ14107 fwYellow-targeting sgRNA
(Plasmid
#239456)
-
Purposeguide for fwYellow
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression, CRISPR ; Cell-free system using bacterial extract
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameguide targeting fwYellow
-
gRNA/shRNA sequenceTTTACCGACGCTCGCGTCAC
- Promoter J23119
Cloning Information
- Cloning method Other
- 5′ sequencing primer na (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ14107 fwYellow-targeting sgRNA was a gift from Stanley Qi (Addgene plasmid # 239456 ; http://n2t.net/addgene:239456 ; RRID:Addgene_239456) -
For your References section:
A frugal CRISPR kit for equitable and accessible education in gene editing and synthetic biology. Collins M, Lau MB, Ma W, Shen A, Wang B, Cai S, La Russa M, Jewett MC, Qi LS. Nat Commun. 2024 Aug 3;15(1):6563. doi: 10.1038/s41467-024-50767-2. 10.1038/s41467-024-50767-2 PubMed 39095367