pMDS1
(Plasmid
#239460)
-
Purpose(Empty Backbone) For simultaneous monitoring of both transcription and translation of genes in plant tissues: C-terminus fusion
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMCY2
-
Modifications to backboneWe have incorporated a module that allows the visualisation of transcription and translation in one go. pMDS1 provides the following C-terminal fusion VENUS:3xHA:2A:mTurqN7
-
Vector typeBacterial Expression, Plant Expression
-
Selectable markersPlasma membrane mCherry marker for seed selection
-
Tag
/ Fusion Protein
- VENUS:3xHA:2A:mTurqN7 (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSuccessful cloning can be tested via Blue-White selection
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For cloning a promoter + gene fragment (without stop codon) via Gibson Assembly, we recommend the following approach:
Primer design:
Forward primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC PRIMER 3’
Reverse primer: 5’ CAGAACCACCACCTCCGGATCC+GENE SPECIFIC PRIMER W/O STOP CODON 3'
Digest pMDS1 plasmid with SAP I enzyme
Clean up
Perform Gibson assembly reaction
Transform E. coli (DH5alpha)
Select on LB + Sp + Sm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDS1 was a gift from Miguel de Lucas (Addgene plasmid # 239460 ; http://n2t.net/addgene:239460 ; RRID:Addgene_239460) -
For your References section:
Elucidating tissue and subcellular specificity of the entire SUMO network reveals how stress responses are fine-tuned in a eukaryote. Banda J, Ghosh S, Roy D, Ingole KD, Clark L, Sharma E, Kakkunath S, Sue-Ob K, Bhosale R, Band L, Ghosh S, Wells D, Atkinson J, Provart NJ, Bennett MJ, Lilley KS, Jones A, De Lucas M, Bishopp A, Sadanandom A. Sci. Adv., 11, eadw9153 (2025) 10.1126/sciadv.adw9153