pSG1039-rA1-SaKKH_P2A_EGFP
(Plasmid
#239462)
-
PurposeCytosine base editor with codon-optimized S. aureus KKH Cas9 and rAPOBEC1 deaminase. EGFP can be used as a transfection marker.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4361
- Total vector size (bp) 8244
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS.a. rA1 CBE
-
Alt nameCBE
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG1039-rA1-SaKKH_P2A_EGFP was a gift from Alexis Komor (Addgene plasmid # 239462 ; http://n2t.net/addgene:239462 ; RRID:Addgene_239462)
Map uploaded by the depositor.
