pT4-U6-sgRNA-CMV-EGFP
(Plasmid
#239587)
-
Purpose(Empty Backbone) Sleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT4-CMV-GFP (#117046)
-
Backbone manufacturerWolfgang Uckert
- Backbone size (bp) 4999
-
Modifications to backboneInsertion of RNA-polIII, U6 expression cassette, upstream to the visual marker
-
Vector typeMammalian Expression ; Sleeping beauty transposone
- Promoter hU6
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Other
- 5′ sequencing primer T7: TAATACGACTCACTATAGGG
- 3′ sequencing primer CMV-rev: AGTAGGAAAGTCCCGTAAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
based on pT4-CMV-GFP (AddGene #117046), the sgRNA cloning and expression cassette derives from lentiCRISPR v2 (AddGene #52961)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT4-U6-sgRNA-CMV-EGFP was a gift from Andreas Moor (Addgene plasmid # 239587 ; http://n2t.net/addgene:239587 ; RRID:Addgene_239587) -
For your References section:
In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831