Skip to main content

pT4-U6-sgRNA-CMV-EGFP
(Plasmid #239587)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239587 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT4-CMV-GFP (#117046)
  • Backbone manufacturer
    Wolfgang Uckert
  • Backbone size (bp) 4999
  • Modifications to backbone
    Insertion of RNA-polIII, U6 expression cassette, upstream to the visual marker
  • Vector type
    Mammalian Expression ; Sleeping beauty transposone
  • Promoter hU6
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer T7: TAATACGACTCACTATAGGG
  • 3′ sequencing primer CMV-rev: AGTAGGAAAGTCCCGTAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

based on pT4-CMV-GFP (AddGene #117046), the sgRNA cloning and expression cassette derives from lentiCRISPR v2 (AddGene #52961)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT4-U6-sgRNA-CMV-EGFP was a gift from Andreas Moor (Addgene plasmid # 239587 ; http://n2t.net/addgene:239587 ; RRID:Addgene_239587)
  • For your References section:

    In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831