sgPlxnb2-2 in pT4-U6-sgRNA-CMV-EGFP
(Plasmid
#239589)
-
Purposeexpresses guide#2 to boost the expression of mouse Plxnb2, via CRISPRa
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT4-U6-sgRNA-CMV-EGFP (#239587)
-
Backbone manufacturerD Eletto
- Backbone size w/o insert (bp) 7260
- Total vector size (bp) 5399
-
Vector typeMammalian Expression ; Sleeping beauty (SB) transposon
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting TSS-upstream reagion of Plxnb2
-
Alt namePlxnb2
-
gRNA/shRNA sequencesgPlxnb2-2: ggacgagactaaggggtaga
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_138749
-
Entrez GenePlxnb2 (a.k.a. Debt, plexin-B2)
- Promoter hU6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer hU6-f: 5' GAGGGCCTATTTCCCATGATT 3'
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgPlxnb2-2 in pT4-U6-sgRNA-CMV-EGFP was a gift from Andreas Moor (Addgene plasmid # 239589 ; http://n2t.net/addgene:239589 ; RRID:Addgene_239589) -
For your References section:
In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831