Skip to main content
Addgene

sgPlxnb2-3 in pT4-U6-sgRNA-CMV-EGFP
(Plasmid #239590)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239590 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pT4-U6-sgRNA-CMV-EGFP (#239587)
  • Backbone manufacturer
    D Eletto
  • Backbone size w/o insert (bp) 7260
  • Total vector size (bp) 5399
  • Vector type
    Mammalian Expression ; Sleeping beauty (SB) transposon
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting TSS-upstream reagion of Plxnb2
  • Alt name
    Plxnb2
  • gRNA/shRNA sequence
    sgPlxnb2-3: gggaaacgcggggtacgcta
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_138749
  • Entrez Gene
    Plxnb2 (a.k.a. Debt, plexin-B2)
  • Promoter hU6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgPlxnb2-3 in pT4-U6-sgRNA-CMV-EGFP was a gift from Andreas Moor (Addgene plasmid # 239590 ; http://n2t.net/addgene:239590 ; RRID:Addgene_239590)
  • For your References section:

    In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831