AAV-U6-sgPlxnb2-KO-1-EF1a-LibVec
(Plasmid
#239597)
-
Purposeexpresses guide#1 to knock-out mouse Plxnb2, via CRISPR-Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAV-U6-sgRNA-EF1a-LibVec
-
Backbone manufacturerD Eletto
- Backbone size w/o insert (bp) 7453
- Total vector size (bp) 5593
-
Vector typeMammalian Expression, AAV
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlxnb2
-
gRNA/shRNA sequencesgPlxnb2-KO-1: gTTCTCACGGACTTTATCTAG
-
SpeciesM. musculus (mouse)
-
Entrez GenePlxnb2 (a.k.a. Debt, plexin-B2)
- Promoter hU6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer hU6-f: 5' GAGGGCCTATTTCCCATGATT 3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-sgPlxnb2-KO-1-EF1a-LibVec was a gift from Andreas Moor (Addgene plasmid # 239597 ; http://n2t.net/addgene:239597 ; RRID:Addgene_239597) -
For your References section:
In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831