TRE3G-ZIM3-Cas9-P2A-GFP
(Plasmid
#239605)
-
PurposeDoxycycline inducible CRISPRgenee construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTRE3G-Cas9-P2A-GFP
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZIM3 KRAB domain
-
Insert Size (bp)414
-
Entrez GeneZIM3 (a.k.a. ZNF657)
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGAGCTCGTTTAGTGAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE3G-ZIM3-Cas9-P2A-GFP was a gift from Philipp Rathert (Addgene plasmid # 239605 ; http://n2t.net/addgene:239605 ; RRID:Addgene_239605) -
For your References section:
CRISPR GENome and epigenome engineering improves loss-of-function genetic-screening approaches. Stadager J, Bernardini C, Hartmann L, May H, Wiepcke J, Kuban M, Najafova Z, Johnsen SA, Legewie S, Traube FR, Jude J, Rathert P. Cell Rep Methods. 2025 Jun 16;5(6):101078. doi: 10.1016/j.crmeth.2025.101078. Epub 2025 Jun 10. 10.1016/j.crmeth.2025.101078 PubMed 40499551