pAAV-UbC-CytoTape-HaloTag
(Plasmid
#239616)
-
PurposeCytoTape timestamp monomer for encoding time along the CytoTape fiber for cell culture applications
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAAV-UbC
-
Backbone manufacturerEpoch Life Science, Inc.
- Backbone size w/o insert (bp) -3
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytoTape-Halotag
-
SpeciesSynthetic
- Promoter UbC promoter
-
Tag
/ Fusion Protein
- Halotag-dMBP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
- 3′ sequencing primer GCAAACAACAGATGGCTGGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-UbC-CytoTape-HaloTag was a gift from Changyang Linghu (Addgene plasmid # 239616 ; http://n2t.net/addgene:239616 ; RRID:Addgene_239616) -
For your References section:
Multiplexed, scalable analog recording of gene regulation dynamics over weeks using intracellular protein tapes. Zheng L, Yan Y, Zhou B, Lim J, Shi D, An B, Ko B, Klyder E, Pitchiaya S, Cai DJ, Boyden ES, Wei D, Liò P, Linghu C. bioRxiv 2025.05.10.653182 10.1101/2025.05.10.653182