pSGEP-shFos_2
(Plasmid
#239619)
-
PurposeshRNA-mediated knockdown of murine Fos
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneSGEP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshFos_2
-
gRNA/shRNA sequencettaattccaataatgaacccaa
-
SpeciesM. musculus (mouse)
-
Entrez GeneFos (a.k.a. D12Rfj1, c-fos, cFos)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSGEP-shFos_2 was a gift from Reza Kalhor (Addgene plasmid # 239619 ; http://n2t.net/addgene:239619 ; RRID:Addgene_239619)