pStUbi7::FLS2XL-EGFP
(Plasmid
#239620)
-
PurposeExpress FLS2XL in planta under potato StUbi7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGWB404
- Total vector size (bp) 15393
-
Modifications to backboneAdded potato StUbi7 promoter and monomer
-
Vector typePlant Expression
-
Selectable markersnptII
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFLS2XL
-
SpeciesVitis riparia
-
Insert Size (bp)3496
-
GenBank IDPQ283347
- Promoter StUbi7
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Spe1 (unknown if destroyed)
- 5′ sequencing primer CAGATATTTGTGAAAACTCTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGeorg Felix
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pStUbi7::FLS2XL-EGFP was a gift from Gitta Coaker (Addgene plasmid # 239620 ; http://n2t.net/addgene:239620 ; RRID:Addgene_239620)