prhaBAD-anti-mouse-Nb-Hia5
(Plasmid
#239626)
-
PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferase
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepD861
-
Backbone manufacturerATUM Bio
- Backbone size w/o insert (bp) 2260
- Total vector size (bp) 4664
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHia5
-
Alt nameDNA Adenine Methyltransferase
-
SpeciesHaemophilus influenzae
-
Insert Size (bp)843
-
MutationCodon optimized for bacterial expression
-
GenBank IDJF268249.1
- Promoter rhaBAD
-
Tags
/ Fusion Proteins
- MBP (N terminal on insert)
- TEV (N terminal on insert)
- anti-Mouse Nanobody (N terminal on insert)
- 6HIS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGCGCTTTTTAGACTGGTCGTAG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For a protocol for the purification of the proteins, please visit https://www.protocols.io/view/purification-and-activity-testing-for-nanobody-hia-6qpvrqbyzlmk/v1.
Please visit https://doi.org/10.1101/2025.03.11.642717 for bioRxiv preprint.
Plasmids also referenced in https://doi.org/10.1101/2025.07.01.662447.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prhaBAD-anti-mouse-Nb-Hia5 was a gift from Aaron Straight (Addgene plasmid # 239626 ; http://n2t.net/addgene:239626 ; RRID:Addgene_239626) -
For your References section:
DiMeLo-cito: a one-tube protocol for mapping protein-DNA interactions reveals CTCF bookmarking in mitosis. Gamarra N, Chittenden C, Sundararajan K, Schwartz JP, Lundqvist S, Robles D, Dixon-Luinenburg O, Marcus J, Maslan A, Franklin JM, Streets A, Straight AF, Altemose N. bioRxiv [Preprint]. 2025 Mar 14:2025.03.11.642717. doi: 10.1101/2025.03.11.642717. 10.1101/2025.03.11.642717 PubMed 40161611