Skip to main content

pSLQ14112 tyrosinase-targeting sgRNA
(Plasmid #239751)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239751 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression, CRISPR ; Cell-free system using bacterial extract

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    guide targeting tyrosinase
  • gRNA/shRNA sequence
    CATAGATGCCCTTTTCCTTC
  • Promoter J23119

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ14112 tyrosinase-targeting sgRNA was a gift from Stanley Qi (Addgene plasmid # 239751 ; http://n2t.net/addgene:239751 ; RRID:Addgene_239751)
  • For your References section:

    A frugal CRISPR kit for equitable and accessible education in gene editing and synthetic biology. Collins M, Lau MB, Ma W, Shen A, Wang B, Cai S, La Russa M, Jewett MC, Qi LS. Nat Commun. 2024 Aug 3;15(1):6563. doi: 10.1038/s41467-024-50767-2. 10.1038/s41467-024-50767-2 PubMed 39095367