Skip to main content

pCSCG-TM(DPP4)-Fc-pST3Gal1 WT
(Plasmid #239822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239822 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSCG
  • Backbone size w/o insert (bp) 7772
  • Total vector size (bp) 9419
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TM(DPP4)-Fc-pST3Gal1 WT
  • Alt name
    TM(DPP4)-PS1
  • Species
    H. sapiens (human); pig
  • Insert Size (bp)
    1647
  • Mutation
    amino acids 1-59 of pST3Gal1 were deleted
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • human IgG1 Fc region (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGCATTGGTAGCTGCTGTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sriram Neelamegham (Addgene #228819)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert size includes N-terminal TM and Fc portion.
TM(DPP4)-Fc-pST3Gal1 WT shows enzymatic activity for acceptor substrates on mammalian cell surface.

Please visit https://doi.org/10.21203/rs.3.rs-5004188/v1 for the preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSCG-TM(DPP4)-Fc-pST3Gal1 WT was a gift from Sriram Neelamegham (Addgene plasmid # 239822 ; http://n2t.net/addgene:239822 ; RRID:Addgene_239822)
  • For your References section:

    Mammalian Cell Surface Display for High-Throughput Protein Engineering of Glycosyltransferases. Hombu R, Neelamegham S. Small. 2025 May 26:e2502318. doi: 10.1002/smll.202502318. 10.1002/smll.202502318 PubMed 40417887