pLKO.1 puro-shGPR43-1
(Plasmid #239860)

• Purpose: shRNA plasmid targeting human GPR43 (sequence: 5'-CGTGGTGTTCAGTTCACTCAA-3'), used to study acetate effects in HK-2 cells.
• Depositing Lab: Weiwei Li
• Publication: shRNA plasmids targeting GPR43 in human HK-2 cells (unpublished)

Backbone

• Vector backbone: pLKO.1-puro
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 7100
• Modifications to backbone: None
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Depositing lab uses Stbl3 strain for stable propagation. Avoid long-term culture to prevent recombination.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GPR43
• Alt name: FFAR2
• gRNA/shRNA sequence: CGTGGTGTTCAGTTCACTCAA
• Species: H. sapiens (human)
• GenBank ID: NM_005306 2867
• Entrez Gene: FFAR2 (a.k.a. FFA2R, GPR43)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: GACTATCATATGCTTACCGT
• 3′ sequencing primer: TTGGAAGGGCGATCGGTGCG

Resource Information

• Supplemental Documents:
  • pLKO.1 puro-shGPR43-1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Constructed using standard pLKO.1 backbone. Validated in HK-2 cells targeting human GPR43.