pPMEL-hbb
(Plasmid
#239863)
-
PurposeTemplate for in vitro transcription of PMEL (gp100), including native signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239863 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3Control
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3636
- Total vector size (bp) 5806
-
Modifications to backboneIntroduction of multiple cloning site at 3' end of luciferase gene.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull premelanosome coding sequence including native signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs
-
Alt namePMEL
-
Alt namegp100
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2170
-
MutationValine to Glycine change is at amino acid 26 of nascent protein. This results in immunogenic KVP to KGP change at N-terminal of mature protein, immediately downstream of signal peptide.
-
GenBank IDNM_006928
-
Entrez GenePMEL (a.k.a. D12S53E, HMB-45, HMB45, ME20, ME20-M, ME20M, P1, P100, PMEL17, SI, SIL, SILV, gp100)
- Promoter T7 (included as part of insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGCGATCTGCATCTCAATTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDesigned as a Gene Block based on NCBI sequence.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPMEL-hbb was a gift from Catherine Jopling (Addgene plasmid # 239863 ; http://n2t.net/addgene:239863 ; RRID:Addgene_239863) -
For your References section:
A proximity-labeling-based approach to directly detect mRNA delivery to specific subcellular locations. Smart AD, Hughes ME, Ruiz Velasco AD, Hori N, Stolnik S, Jopling CL. Mol Ther Nucleic Acids. 2025 Jun 24;36(3):102602. doi: 10.1016/j.omtn.2025.102602. eCollection 2025 Sep 9. 10.1016/j.omtn.2025.102602 PubMed 40661784