MFN2-Halo donor plasmid
(Plasmid
#239866)
-
Purposeendogenously tags MFN2 with Halo tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57-BsaI-free
-
Vector typeDonor plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMFN2
-
SpeciesH. sapiens (human)
-
Entrez GeneMFN2 (a.k.a. CMT2A, CMT2A2, CMT2A2A, CMT2A2B, CPRP1, HMSN6A, HSG, MARF, MSL)
-
Tag
/ Fusion Protein
- Halo Tag (C terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe had this plasmid synthesized by GeneUniversal
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was used to endogenously tag MFN2 with HaloTag via nucleofection. Sequence of guides used with nucleofection ACCTGCAGCCCAGCAGATAG, GTACCTGCAGCCCAGCAGAT.
Please visit https://doi.org/10.1101/2025.02.19.639160 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MFN2-Halo donor plasmid was a gift from Derek Narendra (Addgene plasmid # 239866 ; http://n2t.net/addgene:239866 ; RRID:Addgene_239866) -
For your References section:
A unified mechanism for mitochondrial damage sensing in PINK1-Parkin-mediated mitophagy. Thayer JA, Petersen JD, Huang X, Gruel Budet LM, Hawrot J, Ramos DM, Sekine S, Li Y, Ward ME, Narendra DP. EMBO J. 2025 Nov 20. doi: 10.1038/s44318-025-00604-z. 10.1038/s44318-025-00604-z PubMed 41266657