Skip to main content

MFN2-Halo donor plasmid
(Plasmid #239866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57-BsaI-free
  • Vector type
    Donor plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MFN2
  • Species
    H. sapiens (human)
  • Entrez Gene
    MFN2 (a.k.a. CMT2A, CMT2A2, CMT2A2A, CMT2A2B, CPRP1, HMSN6A, HSG, MARF, MSL)
  • Tag / Fusion Protein
    • Halo Tag (C terminal on insert)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We had this plasmid synthesized by GeneUniversal

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was used to endogenously tag MFN2 with HaloTag via nucleofection. Sequence of guides used with nucleofection ACCTGCAGCCCAGCAGATAG, GTACCTGCAGCCCAGCAGAT.
Please visit https://doi.org/10.1101/2025.02.19.639160 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MFN2-Halo donor plasmid was a gift from Derek Narendra (Addgene plasmid # 239866 ; http://n2t.net/addgene:239866 ; RRID:Addgene_239866)
  • For your References section:

    A unified mechanism for mitochondrial damage sensing in PINK1-Parkin-mediated mitophagy. Thayer JA, Petersen JD, Huang X, Gruel Budet LM, Hawrot J, Ramos DM, Sekine S, Li Y, Ward ME, Narendra DP. EMBO J. 2025 Nov 20. doi: 10.1038/s44318-025-00604-z. 10.1038/s44318-025-00604-z PubMed 41266657