pX458-MFSD6
(Plasmid
#239951)
-
PurposeEncodes gRNA for human MFSD6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX458-GFP
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMFSD6
-
gRNA/shRNA sequenceGGTGGTGGTAACAATAACAG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-MFSD6 was a gift from Jan Carette (Addgene plasmid # 239951 ; http://n2t.net/addgene:239951 ; RRID:Addgene_239951) -
For your References section:
MFSD6 is an entry receptor for enterovirus D68. Varanese L, Xu L, Peters CE, Pintilie G, Roberts DS, Raj S, Liu M, Ooi YS, Diep J, Qiao W, Richards CM, Callaway J, Bertozzi CR, Jabs S, de Vries E, van Kuppeveld FJM, Nagamine CM, Chiu W, Carette JE. Nature. 2025 Mar 25. doi: 10.1038/s41586-025-08908-0. 10.1038/s41586-025-08908-0 PubMed 40132641