pLKO.1 puro-shGPR43-2
(Plasmid
#239956)
-
PurposeshRNA plasmid targeting human GPR43 (sequence: 5'-GCTACGAGAACTTCACCGATA-3') for knockdown studies in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1-puro
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7100
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDepositing lab uses Stbl3 strain for stable propagation. Avoid long-term culture to prevent recombination.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGPR43
-
Alt nameFFAR2
-
gRNA/shRNA sequenceGCTACGAGAACTTCACCGATA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005306 2867
-
Entrez GeneFFAR2 (a.k.a. FFA2R, GPR43)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer TTGGAAGGGCGATCGGTGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Constructed using standard pLKO.1 backbone. Validated in HK-2 cells targeting human GPR43.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 puro-shGPR43-2 was a gift from Weiwei Li (Addgene plasmid # 239956)