Skip to main content
Addgene

pLKO.1 puro-shNC
(Plasmid #239957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239957 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 7100
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Depositing lab uses Stbl3 strain for stable propagation. Avoid long-term culture to prevent recombination.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    non-targeting shRNA control
  • gRNA/shRNA sequence
    CCTAAGGTTAAGTCGCCCTCG
  • Species
    H. sapiens (human)
  • GenBank ID
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer TTGGAAGGGCGATCGGTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Constructed using standard pLKO.1 backbone. Validated in HK-2 cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 puro-shNC was a gift from Weiwei Li (Addgene plasmid # 239957)