6xHsa.NFKB:Kaede
(Plasmid
#239992)
-
PurposeKaede driven by NFkB activity can be switched from green to red fluorescence by UV light exposure, enabling tracking of NFkB positive cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNFkB:EGFP
-
Backbone manufacturerJohn Rawls (Addgene plasmid #44922)
- Backbone size w/o insert (bp) 6534
- Total vector size (bp) 7212
-
Modifications to backboneThe eGFP from pNFkB:EGFP backbone was excised using ClaI (R0197S, NEB) and NcoI-HF (R3193S, NEB) following the manufacturers’ instructions.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namephoto convertible Kaede
-
Alt nameKaede
-
SpeciesTrachyphyllia geoffroyi
-
Insert Size (bp)677
-
GenBank IDAB085641.1
- Promoter cfos minimal promoter
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gaggatccaccggtcgccacatgagtctgattaaa ccagaaatg
- 3′ sequencing primer tatcatgtctggatcatcatcgatttacttgacgttgtcc gg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene was amplified from a plasmid by PCR and subcloned into pNFkB backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHsa.NFKB:Kaede was a gift from Raquel Espin-Palazon (Addgene plasmid # 239992 ; http://n2t.net/addgene:239992 ; RRID:Addgene_239992)