6xHsa.NFKB:Kaede
(Plasmid #239992)

• Purpose: Kaede driven by NFkB activity can be switched from green to red fluorescence by UV light exposure, enabling tracking of NFkB positive cells
• Depositing Lab: Raquel Espin-Palazon
• Publication: p65 signaling dynamics drive the developmental progression of hematopoietic stem and progenitor cells through cell cycle regulation. (unpublished)

Backbone

• Vector backbone: pNFkB:EGFP
• Backbone manufacturer: John Rawls (Addgene plasmid #44922)
• Backbone size w/o insert (bp): 6534
• Total vector size (bp): 7212
• Modifications to backbone: The eGFP from pNFkB:EGFP backbone was excised using ClaI (R0197S, NEB) and NcoI-HF (R3193S, NEB) following the manufacturers’ instructions.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: photo convertible Kaede
• Alt name: Kaede
• Species: Trachyphyllia geoffroyi
• Insert Size (bp): 677
• GenBank ID: AB085641.1
• Promoter: cfos minimal promoter
• Tag / Fusion Protein:
  • NA

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gaggatccaccggtcgccacatgagtctgattaaa ccagaaatg
• 3′ sequencing primer: tatcatgtctggatcatcatcgatttacttgacgttgtcc gg

Resource Information

• Supplemental Documents:
  • cpE_59-NFkB-Kaede updated.gb
• A portion of this plasmid was derived from a plasmid made by: Gene was amplified from a plasmid by PCR and subcloned into pNFkB backbone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry