lenti-hygro-sgDDX6-1
(Plasmid
#240004)
-
PurposeExpresses human sgDDX6 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti-hygro
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgDDX6
-
gRNA/shRNA sequenceCTGAAGAAGGACAATATACA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-hygro-sgDDX6-1 was a gift from Rui Su (Addgene plasmid # 240004 ; http://n2t.net/addgene:240004 ; RRID:Addgene_240004) -
For your References section:
DDX6 undergoes phase separation to modulate metabolic plasticity and chemoresistance. Bi H, Li W, Ren L, Zhang H, Dong L, Chan A, Wang X, Yang L, Zhang X, Xue M, Qin H, Wu X, Hoeve-Scott JT, Zhang B, Li L, Wunderlich M, Mulloy JC, Rosen ST, Chen J, Li X, Chen CW, Su R. Nat Commun. 2025 Dec 2;17(1):260. doi: 10.1038/s41467-025-66966-4. 10.1038/s41467-025-66966-4 PubMed 41330929