pAAV-CMV-DIO-SaCas9-U6-sgDaglb
(Plasmid
#240023)
-
PurposeKnockdown expression of Daglb
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX601-AAV-CMV::NLS-SaCas9-NLS- 3xHA-bGHpA;U6::BsaI-sgRNA
- Total vector size (bp) 7481
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namediacylglycerol lipase, beta
-
Alt nameE330036I19Rik
-
gRNA/shRNA sequenceCCCATCATTGACCAGTCTGCG
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_144915
-
Entrez GeneDaglb (a.k.a. E330036I19Rik)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknow (unknown if destroyed)
- 3′ cloning site Unknow (unknown if destroyed)
- 5′ sequencing primer U6F, LKO-15
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-DIO-SaCas9-U6-sgDaglb was a gift from Huaibin Cai (Addgene plasmid # 240023 ; http://n2t.net/addgene:240023 ; RRID:Addgene_240023) -
For your References section:
Deficiency in endocannabinoid synthase DAGLB contributes to early onset Parkinsonism and murine nigral dopaminergic neuron dysfunction. Liu Z, Yang N, Dong J, Tian W, Chang L, Ma J, Guo J, Tan J, Dong A, He K, Zhou J, Cinar R, Wu J, Salinas AG, Sun L, Kumar M, Sullivan BT, Oldham BB, Pitz V, Makarious MB, Ding J, Kung J, Xie C, Hawes SL, Wang L, Wang T, Chan P, Zhang Z, Le W, Chen S, Lovinger DM, Blauwendraat C, Singleton AB, Cui G, Li Y, Cai H, Tang B. Nat Commun. 2022 Jun 17;13(1):3490. doi: 10.1038/s41467-022-31168-9. 10.1038/s41467-022-31168-9 PubMed 35715418