pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
(Plasmid
#240044)
-
PurposeKnockdown expression of Gabbr1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX601-AAV-CMV::NLS-SaCas9-NLS- 3xHA-bGHpA;U6::BsaI-sgRNA
- Total vector size (bp) 7481
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegamma-aminobutyric acid type B receptor subunit 1
-
Alt nameGABAB1
-
Alt nameGABAbR1
-
gRNA/shRNA sequenceGCGCCACACTCCACAATCCCAC
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_019439
-
Entrez GeneGabbr1 (a.k.a. GABAB1, GABAbR1, bM573K1.1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknow (unknown if destroyed)
- 3′ cloning site Unknow (unknown if destroyed)
- 5′ sequencing primer U6F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-DIO-SaCas9-U6-sgGabbr1 was a gift from Huaibin Cai (Addgene plasmid # 240044 ; http://n2t.net/addgene:240044 ; RRID:Addgene_240044) -
For your References section:
Molecularly distinct striatonigral neuron subtypes differentially regulate locomotion. Dong J, Wang L, Sullivan BT, Sun L, Martinez Smith VM, Chang L, Ding J, Le W, Gerfen CR, Cai H. Nat Commun. 2025 Mar 19;16(1):2710. doi: 10.1038/s41467-025-58007-x. 10.1038/s41467-025-58007-x PubMed 40108161