Skip to main content

pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
(Plasmid #240044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240044 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX601-AAV-CMV::NLS-SaCas9-NLS- 3xHA-bGHpA;U6::BsaI-sgRNA
  • Total vector size (bp) 7481
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gamma-aminobutyric acid type B receptor subunit 1
  • Alt name
    GABAB1
  • Alt name
    GABAbR1
  • gRNA/shRNA sequence
    GCGCCACACTCCACAATCCCAC
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_019439
  • Entrez Gene
    Gabbr1 (a.k.a. GABAB1, GABAbR1, bM573K1.1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknow (unknown if destroyed)
  • 3′ cloning site Unknow (unknown if destroyed)
  • 5′ sequencing primer U6F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-DIO-SaCas9-U6-sgGabbr1 was a gift from Huaibin Cai (Addgene plasmid # 240044 ; http://n2t.net/addgene:240044 ; RRID:Addgene_240044)
  • For your References section:

    Molecularly distinct striatonigral neuron subtypes differentially regulate locomotion. Dong J, Wang L, Sullivan BT, Sun L, Martinez Smith VM, Chang L, Ding J, Le W, Gerfen CR, Cai H. Nat Commun. 2025 Mar 19;16(1):2710. doi: 10.1038/s41467-025-58007-x. 10.1038/s41467-025-58007-x PubMed 40108161