pAAV-CAG-cyOFP-WPRE
(Plasmid
#240050)
-
PurposeAn AAV genome that ubiquitously expresses the fluorescent protein cyOFP from the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecyOFP-H
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer Cag-Fw: gttcggcttctggcgtgtgac
- 3′ sequencing primer post-EcoRI-Rv: ctttcacaaattttgtaatccagaggttgattatc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Michael Lin
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-cyOFP-WPRE was a gift from Mark Schnitzer (Addgene plasmid # 240050 ; http://n2t.net/addgene:240050 ; RRID:Addgene_240050) -
For your References section:
Imaging high-frequency voltage dynamics in multiple neuron classes of behaving mammals. Haziza S, Chrapkiewicz R, Zhang Y, Kruzhilin V, Li J, Li J, Delamare G, Swanson R, Buzsaki G, Kannan M, Vasan G, Lin MZ, Zeng H, Daigle TL, Schnitzer MJ. Cell, 188, 1-23, August 7, 2025. doi: 10.1016/j.cell.2025.06.028 10.1016/j.cell.2025.06.028 PubMed 39185175