Skip to main content

pAAV-CAG-cyOFP-WPRE
(Plasmid #240050)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240050 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cyOFP-H
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer Cag-Fw: gttcggcttctggcgtgtgac
  • 3′ sequencing primer post-EcoRI-Rv: ctttcacaaattttgtaatccagaggttgattatc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Michael Lin
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-cyOFP-WPRE was a gift from Mark Schnitzer (Addgene plasmid # 240050 ; http://n2t.net/addgene:240050 ; RRID:Addgene_240050)
  • For your References section:

    Imaging high-frequency voltage dynamics in multiple neuron classes of behaving mammals. Haziza S, Chrapkiewicz R, Zhang Y, Kruzhilin V, Li J, Li J, Delamare G, Swanson R, Buzsaki G, Kannan M, Vasan G, Lin MZ, Zeng H, Daigle TL, Schnitzer MJ. Cell, 188, 1-23, August 7, 2025. doi: 10.1016/j.cell.2025.06.028 10.1016/j.cell.2025.06.028 PubMed 39185175