Skip to main content

pLG-mLRRC45 (158 a.a.)
(Plasmid #240067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs
  • Backbone size w/o insert (bp) 4548
  • Total vector size (bp) 6019
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LRRC45 C-terminal 158 a.a.
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    818
  • GenBank ID
    BC023296.1
  • Entrez Gene
    Lrrc45
  • Promoter LTR
  • Tag / Fusion Protein
    • LexA DNA-binding (DB) domain + Gal4 transactivation (TA) domain (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer caatggatgatgtatataactatctattcgat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLG-mLRRC45 (158 a.a.) was a gift from Hodaka Fujii (Addgene plasmid # 240067 ; http://n2t.net/addgene:240067 ; RRID:Addgene_240067)
  • For your References section:

    Novel reporter systems to detect cold and osmotic stress responses. Maruyama K, Fujii H. Biol Methods Protoc. 2025 Jun 14;10(1):bpaf048. doi: 10.1093/biomethods/bpaf048. eCollection 2025. 10.1093/biomethods/bpaf048 PubMed 40585180