pLG-mCCDC91 (198 a.a.)
(Plasmid
#240069)
-
PurposeITT reporter plasmid for cold stress
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMXs
- Backbone size w/o insert (bp) 4548
- Total vector size (bp) 6765
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCDC91 C-terminal 198 a.a.
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1566
-
GenBank IDBC049073.1
-
Entrez GeneCcdc91 (a.k.a. 1700086G08Rik, 1810060J02Rik, p56)
- Promoter LTR
-
Tag
/ Fusion Protein
- LexA DNA-binding (DB) domain + Gal4 transactivation (TA) domain (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer caatggatgatgtatataactatctattcgat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLG-mCCDC91 (198 a.a.) was a gift from Hodaka Fujii (Addgene plasmid # 240069 ; http://n2t.net/addgene:240069 ; RRID:Addgene_240069) -
For your References section:
Novel reporter systems to detect cold and osmotic stress responses. Maruyama K, Fujii H. Biol Methods Protoc. 2025 Jun 14;10(1):bpaf048. doi: 10.1093/biomethods/bpaf048. eCollection 2025. 10.1093/biomethods/bpaf048 PubMed 40585180