pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
(Plasmid
#240094)
-
PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX601
- Total vector size (bp) 7500
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6 driven sgRNA Targeting exon 1 of EZR
-
Alt nameEZR
-
gRNA/shRNA sequenceTGGCTGGTTGGTGGCTCTGC
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_009510.2
-
Entrez GeneEzr (a.k.a. Vil2, p81)
- Promoter GfaABC1D
-
Tag
/ Fusion Protein
- SaCas9 + 3X HA-Tag
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer - (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1 was a gift from Mark Verheijen (Addgene plasmid # 240094 ; http://n2t.net/addgene:240094 ; RRID:Addgene_240094) -
For your References section:
Retraction of Astrocyte Leaflets From the Synapse Enhances Fear Memory. Badia-Soteras A, Heistek TS, Kater MSJ, Mak A, Negrean A, van den Oever MC, Mansvelder HD, Khakh BS, Min R, Smit AB, Verheijen MHG. Biol Psychiatry. 2023 Aug 1;94(3):226-238. doi: 10.1016/j.biopsych.2022.10.013. Epub 2022 Oct 29. 10.1016/j.biopsych.2022.10.013 PubMed 36702661