pUBC-popTag-QtE-mScarlet
(Plasmid
#240101)
-
PurposeMammalian lentiviral vector for expressing the mScarlet-tagged 50nm-GEMs, encoded by the encapsulin protein from Quasibacillus thermotolerans and fused to a PopZ tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiviral vector
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEncapsulin
-
SpeciesQuasibacillus thermotolerans
- Promoter UBC promoter
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- popZ (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaggaatagaagaagaaggtggaga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUBC-popTag-QtE-mScarlet was a gift from Liam Holt (Addgene plasmid # 240101 ; http://n2t.net/addgene:240101 ; RRID:Addgene_240101) -
For your References section:
Polysome collapse and RNA condensation fluidize the cytoplasm. Xie Y, Shu T, Liu T, Spindler MC, Mahamid J, Hocky GM, Gresham D, Holt LJ. Mol Cell. 2024 Jul 25;84(14):2698-2716.e9. doi: 10.1016/j.molcel.2024.06.024. 10.1016/j.molcel.2024.06.024 PubMed 39059370