pL6puro-pmRevErbA-Venus-NLS-Pest
(Plasmid
#240105)
-
PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti6-puromycin
-
Backbone manufacturerVectorBuilder
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemurine Nr1d1 promoter+Venus-NLS-Pest-Reporter
-
Alt namemREVERBa promoter
-
SpeciesM. musculus (mouse)
-
Entrez GeneNr1d1 (a.k.a. A530070C09Rik)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GAAGGAATAGAAGAAGAAGG
- 3′ sequencing primer TCCAATGGCAGCTTCCAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNagoshi et al. 2004 (doi: 10.1016/j.cell.2004.11.015, PMID: 15550250)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Low expression. Refer to JeT or SV40 promoter containing variants. Please visit https://doi.org/10.1101/2025.06.30.661926 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL6puro-pmRevErbA-Venus-NLS-Pest was a gift from Achim Kramer (Addgene plasmid # 240105 ; http://n2t.net/addgene:240105 ; RRID:Addgene_240105) -
For your References section:
A lentiviral fluorescent reporter to study circadian rhythms in single cells. Gabriel CH, Lehmann L, Ahlburg J, Achim Kramer A. bioRxiv 2025.06.30.661926 10.1101/2025.06.30.661926