pL6puro-pSV40(3)-pmRevErbA-Venus-NLS-Pest
(Plasmid #240114)

• Purpose: A lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.
• Depositing Lab: Achim Kramer
• Publication: Gabriel et al bioRxiv 2025.06.30.661926

Backbone

• Vector backbone: pLenti6-puromycin
• Backbone manufacturer: VectorBuilder
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: murine Nr1d1 promoter+Venus-NLS-Pest-Reporter
• Alt name: mREVERBa promoter
• Species: M. musculus (mouse)
• Mutation: added SV40-Enhancer
• Entrez Gene: Nr1d1 (a.k.a. A530070C09Rik)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ctgggacagagggctct
• 3′ sequencing primer: TCCAATGGCAGCTTCCAGTC

Resource Information

• Supplemental Documents:
  • pL6puro-pSV40(3)-pmRevErbA-Venus-NLS-Pest.gb
• A portion of this plasmid was derived from a plasmid made by: Nagoshi et al. 2004 (doi: 10.1016/j.cell.2004.11.015, PMID: 15550250)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insertion of SV40 Enhancer. From our analysis in U2OS cells, SV40(3) and JeT variants are superior in reporting circadian rhythms. Please visit https://doi.org/10.1101/2025.06.30.661926 for bioRxiv preprint.