Skip to main content

pL6puro-pSV40(4)-pmRevErbA-Venus-NLS-Pest
(Plasmid #240115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240115 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti6-puromycin
  • Backbone manufacturer
    VectorBuilder
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    murine Nr1d1 promoter+Venus-NLS-Pest-Reporter
  • Alt name
    mREVERBa promoter
  • Species
    M. musculus (mouse)
  • Mutation
    added SV40-Enhancer+Ori
  • Entrez Gene
    Nr1d1 (a.k.a. A530070C09Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ctgggacagagggctct
  • 3′ sequencing primer TCCAATGGCAGCTTCCAGTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Nagoshi et al. 2004 (doi: 10.1016/j.cell.2004.11.015, PMID: 15550250)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insertion of SV40 Enhancer + Ori. From our analysis in U2OS cells, SV40(3) and JeT variants are superior in reporting circadian rhythms. Please visit https://doi.org/10.1101/2025.06.30.661926 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL6puro-pSV40(4)-pmRevErbA-Venus-NLS-Pest was a gift from Achim Kramer (Addgene plasmid # 240115 ; http://n2t.net/addgene:240115 ; RRID:Addgene_240115)
  • For your References section:

    A lentiviral fluorescent reporter to study circadian rhythms in single cells. Gabriel CH, Lehmann L, Ahlburg J, Achim Kramer A. bioRxiv 2025.06.30.661926 10.1101/2025.06.30.661926