His-lsMSP1E3D1
(Plasmid
#240152)
-
PurposeExpression of the MSP 'His-lsMSP1E3D1'
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28
- Backbone size w/o insert (bp) 5246
- Total vector size (bp) 6143
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHis-lsMSP1E3D1
-
SpeciesSynthetic
-
Insert Size (bp)897
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- His-tag (N terminal on insert)
- His-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGGGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-lsMSP1E3D1 was a gift from Lise Arleth (Addgene plasmid # 240152 ; http://n2t.net/addgene:240152 ; RRID:Addgene_240152) -
For your References section:
Non-ionic detergent assists formation of supercharged nanodiscs and insertion of membrane proteins. Tidemand FG, Blemmer S, Johansen NT, Arleth L, Pedersen MC. Biochim Biophys Acta Biomembr. 2022 Jun 1;1864(6):183884. doi: 10.1016/j.bbamem.2022.183884. Epub 2022 Feb 16. 10.1016/j.bbamem.2022.183884 PubMed 35182589