pSMT3-fecB
(Plasmid
#240158)
-
Purposeexpresses FecB of M. marinum in mycobacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSMT3
- Total vector size (bp) 6779
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefecB (MMAR_1650)
-
SpeciesMycobacterium marinum
-
Insert Size (bp)1095
- Promoter HSP60
Cloning Information
- Cloning method Other
- 5′ sequencing primer CACAACGACGCGCCCGCTTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMT3-fecB was a gift from Wilbert Bitter (Addgene plasmid # 240158 ; http://n2t.net/addgene:240158 ; RRID:Addgene_240158) -
For your References section:
A new role for lipoproteins LpqZ and FecB in orchestrating mycobacterial cell envelope biogenesis. Lissner R, Franklin A, Benedict ST, Charitou V, Speer A, Knol J, Jimenez C, Moynihan PJ, Nejentsev S, Kuijl C, Bitter W. mBio. 2025 Dec 12:e0211925. doi: 10.1128/mbio.02119-25. 10.1128/mbio.02119-25 PubMed 41384969