pJM220-PphoA-mNeongreen-J23116-mScarletI
(Plasmid
#240200)
-
PurposeMiniTn7 donor plasmid for constructing a ratiometric reporter for P limitation in Pseudomonas synxantha. A weak Anderson promoter (J23116) drives expression of mScarlet-I
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJM220
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6690
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemNeongreen
- Promoter PphoA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAAGAGTGGAACAATGCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemScarlet-I
- Promoter J23116
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTCCTGTTGATAGATCCAGTAATGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM220-PphoA-mNeongreen-J23116-mScarletI was a gift from Richard Murray (Addgene plasmid # 240200 ; http://n2t.net/addgene:240200 ; RRID:Addgene_240200) -
For your References section:
Engineering the Soil Bacterium Pseudomonas synxantha 2-79 into a Ratiometric Bioreporter for Phosphorus Limitation. Larsson EM, Murray RM, Newman DK. ACS Synth Biol. 2024 Jan 19;13(1):384-393. doi: 10.1021/acssynbio.3c00642. Epub 2024 Jan 2. 10.1021/acssynbio.3c00642 PubMed 38165130