pAAV-TRE-fDIO-seTurboID-IRES-tTA
(Plasmid
#240206)
-
PurposeAmplifier AAV vector of Dual-AAV sparse labeling system encoding seTurboID
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7108
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameseTurboID
-
SpeciesSynthetic
-
Insert Size (bp)1176
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGACAGGGCCAGGTTTCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-fDIO-seTurboID-IRES-tTA was a gift from Rui Lin (Addgene plasmid # 240206 ; http://n2t.net/addgene:240206 ; RRID:Addgene_240206) -
For your References section:
Ultrabright chemical labeling enables rapid neural connectivity profiling in large tissue samples. Zhong S, Zhang X, Gao X, Li Z, Huang L, Guo Q, Gong R, Ren J, Luo M, Lin R. Neuron. 2025 Sep 18:S0896-6273(25)00657-9. doi: 10.1016/j.neuron.2025.08.022. 10.1016/j.neuron.2025.08.022 PubMed 40972576