pSC-MRscRNA
(Plasmid
#240211)
-
PurposeYeast vector expressing theophylline-responsive MR-scRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepUC
- Total vector size (bp) 5265
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTheophylline MR-scRNA targeting TetO
-
gRNA/shRNA sequenceacttttctctatcactgata
-
SpeciesSynthetic
- Promoter SNR52
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWendell Lim and Stanley Qi (Addgene plasmid 62313)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC-MRscRNA was a gift from Wilfred Chen (Addgene plasmid # 240211 ; http://n2t.net/addgene:240211 ; RRID:Addgene_240211) -
For your References section:
Metabolite-responsive scaffold RNAs for dynamic CRISPR transcriptional regulation. Stohr AM, Hansen H, Richards B, Park H, Goncalves AG, Agrawal A, Blenner M, Chen W. Nucleic Acids Res. 2025 Nov 13;53(21):gkaf1290. doi: 10.1093/nar/gkaf1290. 10.1093/nar/gkaf1290 PubMed 41277686