pLV[Exp]-Hygro-cTnT-FUCCIplex
(Plasmid
#240216)
-
PurposeMultiplexable FUCCI sensor (FUCCIplex). The cTnT promoter drives the expression of the fluorescent sensor.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-Hygro
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 8155
- Total vector size (bp) 10573
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFUCCIplex
-
SpeciesSynthetic
-
Insert Size (bp)2418
- Promoter cTnT
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAGCTCACAAGTGTTGCATTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVectorBuilder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.19.629259 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV[Exp]-Hygro-cTnT-FUCCIplex was a gift from Francesco Pasqualini (Addgene plasmid # 240216 ; http://n2t.net/addgene:240216 ; RRID:Addgene_240216) -
For your References section:
CALIPERS: Cell cycle-aware live imaging for phenotyping experiments and regeneration studies. Di Sante M, Pezzotti M, Zimmermann J, Enrico A, Deschamps J, Balmas E, Becca S, Reali A, Bertero A, Jug F, Pasqualini FS. bioRxiv 2024.12.19.629259 10.1101/2024.12.19.629259