R26_CAG_BST_FUCCIplex
(Plasmid
#240241)
-
PurposeROSA26 knock-in vector with homology-mediated end joining(HMEJ)-based method. The CAG promoter drives the expression of the FUCCIplex sensor.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC plasmid
- Backbone size w/o insert (bp) 7195
- Total vector size (bp) 9613
-
Modifications to backboneInserted left and right hROSA26 homology arms, blasticidin resistance gene trap (adenovirus splice acceptor, T2A, BlastR, bGH pA), CAG promoter and bGH polyA
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFUCCIplex
-
SpeciesSynthetic
-
Insert Size (bp)2418
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCCTCTGCTAACCATGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byR26_CAG_BST_FUCCIplex was generated starting from the pR26-Bst_CAG-Tet-On-3G construct, which was a gift from Dr. Alessandro Bertero (https://doi.org/10.12688/openreseurope.19024.1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.19.629259 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R26_CAG_BST_FUCCIplex was a gift from Francesco Pasqualini (Addgene plasmid # 240241 ; http://n2t.net/addgene:240241 ; RRID:Addgene_240241) -
For your References section:
CALIPERS: Cell cycle-aware live imaging for phenotyping experiments and regeneration studies. Di Sante M, Pezzotti M, Zimmermann J, Enrico A, Deschamps J, Balmas E, Becca S, Reali A, Bertero A, Jug F, Pasqualini FS. bioRxiv 2024.12.19.629259 10.1101/2024.12.19.629259