pAAVS-sA-NeoR
(Plasmid
#240383)
-
PurposeFor insertion into AAV Safe Harbor site, provides G418 resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
-
Vector typeUnspecified
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNeoR
-
Insert Size (bp)804
-
Entrez GeneneoR (a.k.a. pSH111_227_223)
- Promoter None. Driven by PPP1R12C promoter after homologous recombination
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccggttaatgtggctctggt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be inserted into the AAV Safe Harbor site in the first intron of PPP1R12C by cleavage with cas9-gRNA. Following homologous recombination, the splice acceptor allows expression of the NeoR gene from the PPP1R12C promoter, making the cell resistant to G418.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS-sA-NeoR was a gift from Ronald Hart (Addgene plasmid # 240383 ; http://n2t.net/addgene:240383 ; RRID:Addgene_240383)