pCDFDuet-NHis6NocM-emptyMCS2
(Plasmid
#240399)
-
Purposeexpresses N-His tagged NocM (acyl carrier protein) from Nodularia sp. 06071
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDFDuet
- Total vector size (bp) 4042
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenocM
-
Alt namenodcylB
-
Alt nameclyB
-
SpeciesNodularia sp. 06071
-
Insert Size (bp)279
-
MutationM1 in native sequence not included in insert
-
GenBank IDMW071172
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGCAACTTTTTGAAGACAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDFDuet-NHis6NocM-emptyMCS2 was a gift from Emily Balskus (Addgene plasmid # 240399 ; http://n2t.net/addgene:240399 ; RRID:Addgene_240399) -
For your References section:
Biochemical Studies of a Cyanobacterial Halogenase Support the Involvement of a Dimetal Cofactor. Wang ML, Glasser NR, Nair MA, Krebs C, Martin Bollinger J Jr, Balskus EP. Biochemistry. 2025 May 20;64(10):2173-2180. doi: 10.1021/acs.biochem.4c00720. Epub 2025 Apr 29. 10.1021/acs.biochem.4c00720 PubMed 40300765