pETDuet-solo-NHis6-NocO-D282A
(Plasmid
#240407)
-
Purposeexpresses N-His tagged NocO D282A (diiron halogenase variant) from Nodularia sp. 06071 (mutation numbering based on amino acid position in native sequence), created from mutagenesis of WT plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETDuet
- Total vector size (bp) 6434
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenocO
-
Alt nameNodcylC
-
Alt nameclyC
-
SpeciesNodularia sp. 06071
-
Insert Size (bp)1299
-
MutationM1 of native sequence not included in insert, Aspartate 279 of native sequence changed to Alanine
-
GenBank IDMW071172
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATTACTAGCAGTAATACTTCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet-solo-NHis6-NocO-D282A was a gift from Emily Balskus (Addgene plasmid # 240407 ; http://n2t.net/addgene:240407 ; RRID:Addgene_240407) -
For your References section:
Biochemical Studies of a Cyanobacterial Halogenase Support the Involvement of a Dimetal Cofactor. Wang ML, Glasser NR, Nair MA, Krebs C, Martin Bollinger J Jr, Balskus EP. Biochemistry. 2025 May 20;64(10):2173-2180. doi: 10.1021/acs.biochem.4c00720. Epub 2025 Apr 29. 10.1021/acs.biochem.4c00720 PubMed 40300765