pMi[3xP3::mCherry-SV40, Plodia-FibL::mBaojin-P10]
(Plasmid
#240410)
-
PurposeFor Minos transgenesis in insect, expresses the 3xP3::mCherry eye/glia transgenesis, and the mBaoJin in Posterior Silk Glands (under the control of the Fibroin-L promoter from Plodia interpunctella)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript, pMi(3xP3-EGFP)
- Backbone size w/o insert (bp) 4018
- Total vector size (bp) 7403
-
Modifications to backboneThe pMi[3xP3::mCherry-SV40, Plodia-FibL::mBaojin-P10] plasmid was produced using Gibson Assembly, by replacing the EGFP-SV40 section of pMi(3xP3::EGFP-SV40) with a synthetic (mCherry-SV40, FibL::mBaojin-P10) gene fragment
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name3xP3::mCherry_SV40terminator
-
SpeciesSynthetic
-
Insert Size (bp)1217
- Promoter 3xP3
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGAGGTCGACGGTATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFibL::mBaojin_P10terminator
-
SpeciesSynthetic
-
Insert Size (bp)2402
-
Entrez GeneFib-l
- Promoter Fibroin-L proximal promoter (Plodia interpunctella)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMi[3xP3::mCherry-SV40, Plodia-FibL::mBaojin-P10] was a gift from Arnaud Martin (Addgene plasmid # 240410 ; http://n2t.net/addgene:240410 ; RRID:Addgene_240410)