Skip to main content
Addgene
Open Menu

pHREP-KD-1
(Plasmid #240416)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240416 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pSBtet-Neo
  • Backbone manufacturer
    Eric Kowarz
  • Backbone size (bp) 6600
  • Modifications to backbone
    Inserted a short version of the mir30a sequences and a Puromycin resistance gene downstream of the Tet promoter
  • Vector type
    Mammalian Expression
  • Promoter TRE
  • Selectable markers
    Neomycin (select with G418), Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHREP-KD-1 was a gift from Lienhard Schmitz (Addgene plasmid # 240416 ; http://n2t.net/addgene:240416 ; RRID:Addgene_240416)

  • For your References section:

    A novel approach towards a histone replacement system in Tetrapods. Pfisterer M, Pritz A, Parry A, Schmitz ML. PLoS One 21(2): e0342014 (2026) 10.1371/journal.pone.0342014
Related items: