pHREP-LP
(Plasmid #240432)

• Purpose: Empty landing pad vector with two Bxb1 recombination sites for RMCE and LNGFR + EGFP-HygroR for sorting/selection.
• Depositing Lab: Lienhard Schmitz
• Publication: Pfisterer et al PLoS One 21(2): e0342014 (2026)

Backbone

• Vector backbone: pUC
• Total vector size (bp): 6485
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LNGFR
• Species: Synthetic
• Insert Size (bp): 822
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Gene/Insert 2

• Gene/Insert name: EGFP
• Insert Size (bp): 717
• Tag / Fusion Protein:
  • Hygromycin Resistance (C terminal on insert)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry