pHREP-LP
(Plasmid
#240432)
-
PurposeEmpty landing pad vector with two Bxb1 recombination sites for RMCE and LNGFR + EGFP-HygroR for sorting/selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Total vector size (bp) 6485
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLNGFR
-
SpeciesSynthetic
-
Insert Size (bp)822
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Insert Size (bp)717
-
Tag
/ Fusion Protein
- Hygromycin Resistance (C terminal on insert)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHREP-LP was a gift from Lienhard Schmitz (Addgene plasmid # 240432 ; http://n2t.net/addgene:240432 ; RRID:Addgene_240432) -
For your References section:
A novel approach towards a histone replacement system in Tetrapods. Pfisterer M, Pritz A, Parry A, Schmitz ML. PLoS One. 2026 Feb 10;21(2):e0342014. doi: 10.1371/journal.pone.0342014. eCollection 2026. 10.1371/journal.pone.0342014 PubMed 41666149