WoFabI-pNIC-Bsa4
(Plasmid
#240437)
-
PurposeExpresses enoyl-ACP reductase FabI [Wolbachia endosymbiont of Brugia malayi] under T7 with HIS tag in bacterial cells)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNIC-Bsa4
-
Backbone manufacturerSGC
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6166
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEnoyl-acyl carrier protein reductase
-
Alt nameEnoyl-ACP reductase
-
Alt namefabI
-
Alt nameWoFabi
-
SpeciesWolbachia endosymbiont of Brugia malayi
-
Insert Size (bp)811
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His-tag (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGTGAGCGGATAACAATTCC
- 3′ sequencing primer AGCAGCCAACTCAGCTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WoFabI-pNIC-Bsa4 was a gift from Josh Beckham (Addgene plasmid # 240437 ; http://n2t.net/addgene:240437 ; RRID:Addgene_240437)