pTE3: pFuGW-SSX1p-GAL4BD-1X3CLpro consensus CS-VP16AD-SV40NLS
(Plasmid
#240456)
-
PurposeA synthetic transcription factor (synTF) that contains concensus 3CLpro cleavage site (CS)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFuGW
- Total vector size (bp) 9453
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSSX1p
-
SpeciesH. sapiens (human)
-
Insert Size (bp)836
- Promoter SSX1p
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ACATAGTTAAGAATACCAGTCAATC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGAL4BD-1X3CLpro consensus CS-VP16AD-SV40NLS
-
Insert Size (bp)682
- Promoter SSX1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CATCATCCTGGAGCAATGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE3: pFuGW-SSX1p-GAL4BD-1X3CLpro consensus CS-VP16AD-SV40NLS was a gift from Lior Nissim (Addgene plasmid # 240456 ; http://n2t.net/addgene:240456 ; RRID:Addgene_240456) -
For your References section:
Optimized pipeline and designer cells for synthetic-biology-based high-throughput screening of viral protease inhibitors. Edri S, El-Atawneh S, Ernst T, Elnekave M, Katzman C, Lanton T, Aldar I, Wolk O, Stern N, Goldblum A, Nissim L. Cell Rep Methods. 2025 Aug 5:101139. doi: 10.1016/j.crmeth.2025.101139. 10.1016/j.crmeth.2025.101139 PubMed 40780218