TPC2-mCherry
(Plasmid
#240468)
-
PurposeRed-tagged lysosomal channel
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5TO
- Backbone size w/o insert (bp) 3964
- Total vector size (bp) 6964
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTPC2N2
-
Alt nameTPC2, two-pore channel 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2256
-
MutationMutated aspartate 276 to lysine.
-
GenBank IDBC141195
-
Entrez GeneTPCN2 (a.k.a. SHEP10, TPC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer gaaatttgtgatgctattgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TPC2-mCherry was a gift from Antony Galione (Addgene plasmid # 240468 ; http://n2t.net/addgene:240468 ; RRID:Addgene_240468) -
For your References section:
Optical profiling of autonomous Ca(2+) nanodomains generated by lysosomal TPC2 and TRPML1. Davis LC, Morgan AJ, Galione A. Cell Calcium. 2023 Dec;116:102801. doi: 10.1016/j.ceca.2023.102801. Epub 2023 Sep 18. 10.1016/j.ceca.2023.102801 PubMed 37742482