pSSBIO32_dCas9_RPA3701
(Plasmid
#240490)
-
PurposeCRISPRi-mediated Knockdown of RPA3701
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBHR1
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Gentamicin, 50 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceCTTTTACACCATGAACCGCGCGG
-
SpeciesStreptococcus pyogenes
-
MutationD10A, H840A
-
Entrez Genecas9 (a.k.a. SPY_RS04360, SPy1046, SPy_1046)
- Promoter Plac
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.15.638337 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSSBIO32_dCas9_RPA3701 was a gift from Rajib Saha (Addgene plasmid # 240490 ; http://n2t.net/addgene:240490 ; RRID:Addgene_240490) -
For your References section:
High enzyme promiscuity in lignin degradation mechanisms in Rhodopseudomonas palustris CGA009. Kathol M, Chowdhury NB, Immethun C, Alsiyabi A, Morris D, Naldrett MJ, Saha R. Appl Environ Microbiol. 2025 Aug 20;91(8):e0057325. doi: 10.1128/aem.00573-25. Epub 2025 Jul 8. 10.1128/aem.00573-25 PubMed 40626778