Skip to main content

p5E itga11a-cFos
(Plasmid #240524)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240524 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p5E-MCS
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 6178
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    integrin α11a - 3.2kb promoter
  • Alt name
    itga11a
  • Alt name
    integrin, alpha 11a
  • Species
    D. rerio (zebrafish)
  • GenBank ID
    NM_001172627.1
  • Entrez Gene
    itga11a (a.k.a. itga11)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13F
  • 3′ sequencing primer CTACCAAACACATGCATAATATCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    cFos - 216bp minimal promoter
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_010234.3
  • Entrez Gene
    Fos (a.k.a. D12Rfj1, c-fos, cFos)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggatattatgcatgtgtttggtag
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p5E itga11a-cFos was a gift from Balázs Enyedi (Addgene plasmid # 240524 ; http://n2t.net/addgene:240524 ; RRID:Addgene_240524)
  • For your References section:

    Fibroblasts promote osmotic surveillance by wound-induced unique calcium patterns. Fazekas L, Kaszas D, Vamosi B, Tamas SX, Szollosi T, Mihalyi V, Dehne FG, Vago-Kiss K, Al-Sheraji NM, Paulovits B, Roux BT, Enyedi B. J Cell Biol. 2026 Jan 5;225(1):e202501165. doi: 10.1083/jcb.202501165. Epub 2025 Oct 22. 10.1083/jcb.202501165 PubMed 41123438