p5E itga11a-cFos
(Plasmid
#240524)
-
Purpose5' Gateway Entry vector containing the itga11a-cFos promoter for fibroblast-specific expression in zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep5E-MCS
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 6178
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameintegrin α11a - 3.2kb promoter
-
Alt nameitga11a
-
Alt nameintegrin, alpha 11a
-
SpeciesD. rerio (zebrafish)
-
GenBank IDNM_001172627.1
-
Entrez Geneitga11a (a.k.a. itga11)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer CTACCAAACACATGCATAATATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecFos - 216bp minimal promoter
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_010234.3
-
Entrez GeneFos (a.k.a. D12Rfj1, c-fos, cFos)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatattatgcatgtgtttggtag
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5E itga11a-cFos was a gift from Balázs Enyedi (Addgene plasmid # 240524 ; http://n2t.net/addgene:240524 ; RRID:Addgene_240524)